54 |
Titel |
TI |
[DE] Verfahren zum Nachweis von HBV [EN] Oligonucleotide primers and probes, for the detection of hepatitis B virus, are used to amplify, by polymerase chain reaction, a section of the hepatitis B virus genome |
71/73 |
Anmelder/Inhaber |
PA |
Drosten, Christian, 60486 Frankfurt, DE
;
Roth, W. Kurt, Priv.-Doz. Dr.med., 65185 Wiesbaden, DE
|
72 |
Erfinder |
IN |
Drosten, Christian, 60486 Frankfurt, DE
;
Roth, W. Kurt, Priv.-Doz. Dr.med., 65185 Wiesbaden, DE
|
22/96 |
Anmeldedatum |
AD |
07.08.1998 |
21 |
Anmeldenummer |
AN |
19835856 |
|
Anmeldeland |
AC |
DE |
|
Veröffentlichungsdatum |
PUB |
17.02.2000 |
33 31 32 |
Priorität |
PRC PRN PRD |
|
51 |
IPC-Hauptklasse |
ICM |
C07H 21/00
|
51 |
IPC-Nebenklasse |
ICS |
|
|
IPC-Zusatzklasse |
ICA |
|
|
IPC-Indexklasse |
ICI |
|
|
Gemeinsame Patentklassifikation |
CPC |
C12Q 1/6823
C12Q 1/686
C12Q 1/706
|
|
MCD-Hauptklasse |
MCM |
|
|
MCD-Nebenklasse |
MCS |
C12Q 1/6823
(2018.01)
C12Q 1/686
(2018.01)
C12Q 1/68
(2006.01)
C12Q 1/70
(2006.01)
|
|
MCD-Zusatzklasse |
MCA |
|
57 |
Zusammenfassung |
AB |
[DE] Es wird ein Verfahren zum Nachweis von HBV in einer Probe beschrieben, welches den Schritt des Aussetzens der Probe einer Polymerase-Kettenreaktion (PCR) umfaßt, wobei das durch die PCR zu amplifizierende DNA-Stück einem bestimmten Teil des HBV-Genoms entspricht. Das Verfahren ist auf besondere Weise auf das sogenannte Taqman DOLLAR I1-System angepaßt. Hierzu werden ferner speziell angepaßte Primerpaare und Nachweissonden zur Verfügung gestellt. [EN] A method of detecting hepatitis B virus (HBV) in a sample comprising exposing the sample to a polymerase chain reaction (PCR), where the PCR amplified DNA fragment corresponds to part of the HBV genome in the region of positions 242-482 of the HBV genome, counted from the single EcoRI cleavage site in the genome, is new. Independent claims are also included for the following: (1) oligonucleotides chosen from (I)-(IV), and complements of (III) and (IV); (2) a plasmid containing a DNA fragment having a 382 bp sequence, fully defined in the specification; and (3) a test kit to detect HBV containing an oligonucleotide composition, the necessary nucleotides for PCR and a heat stable DNA polymerase. CnAACCTSYGTCCTCCAAYTTGT (I); GATGAGGCATAGCAGCAGGAT (II); AACGCCGCAGACACATCCAGCGAT (III); and ACGACGGACCACACTGACCAGTCA (IV). n = 0 or 1; S = C or G; and Y = C or T. |
56 |
Entgegengehaltene Patentdokumente/Zitate, in Recherche ermittelt |
CT |
EP000000523557A1 EP000000569237A2 WO001990013667A1 WO001991010746A1 WO001997040193A2
|
56 |
Entgegengehaltene Patentdokumente/Zitate, vom Anmelder genannt |
CT |
|
56 |
Entgegengehaltene Nichtpatentliteratur/Zitate, in Recherche ermittelt |
CTNP |
|
56 |
Entgegengehaltene Nichtpatentliteratur/Zitate, vom Anmelder genannt |
CTNP |
|
|
Zitierende Dokumente |
|
Dokumente ermitteln
|
|
Sequenzprotokoll |
|
|
|
Prüfstoff-IPC |
ICP |
C07H 21/00
|