Hauptinhalt

Bibliografische Daten

Dokument DE000019835856A1 (Seiten: 22)

Bibliografische Daten Dokument DE000019835856A1 (Seiten: 22)
INID Kriterium Feld Inhalt
54 Titel TI [DE] Verfahren zum Nachweis von HBV
[EN] Oligonucleotide primers and probes, for the detection of hepatitis B virus, are used to amplify, by polymerase chain reaction, a section of the hepatitis B virus genome
71/73 Anmelder/Inhaber PA Drosten, Christian, 60486 Frankfurt, DE ; Roth, W. Kurt, Priv.-Doz. Dr.med., 65185 Wiesbaden, DE
72 Erfinder IN Drosten, Christian, 60486 Frankfurt, DE ; Roth, W. Kurt, Priv.-Doz. Dr.med., 65185 Wiesbaden, DE
22/96 Anmeldedatum AD 07.08.1998
21 Anmeldenummer AN 19835856
Anmeldeland AC DE
Veröffentlichungsdatum PUB 17.02.2000
33
31
32
Priorität PRC
PRN
PRD


51 IPC-Hauptklasse ICM C07H 21/00
51 IPC-Nebenklasse ICS
IPC-Zusatzklasse ICA
IPC-Indexklasse ICI
Gemeinsame Patentklassifikation CPC C12Q 1/6823
C12Q 1/686
C12Q 1/706
MCD-Hauptklasse MCM
MCD-Nebenklasse MCS C12Q 1/6823 (2018.01)
C12Q 1/686 (2018.01)
C12Q 1/68 (2006.01)
C12Q 1/70 (2006.01)
MCD-Zusatzklasse MCA
57 Zusammenfassung AB [DE] Es wird ein Verfahren zum Nachweis von HBV in einer Probe beschrieben, welches den Schritt des Aussetzens der Probe einer Polymerase-Kettenreaktion (PCR) umfaßt, wobei das durch die PCR zu amplifizierende DNA-Stück einem bestimmten Teil des HBV-Genoms entspricht. Das Verfahren ist auf besondere Weise auf das sogenannte Taqman DOLLAR I1-System angepaßt. Hierzu werden ferner speziell angepaßte Primerpaare und Nachweissonden zur Verfügung gestellt.
[EN] A method of detecting hepatitis B virus (HBV) in a sample comprising exposing the sample to a polymerase chain reaction (PCR), where the PCR amplified DNA fragment corresponds to part of the HBV genome in the region of positions 242-482 of the HBV genome, counted from the single EcoRI cleavage site in the genome, is new. Independent claims are also included for the following: (1) oligonucleotides chosen from (I)-(IV), and complements of (III) and (IV); (2) a plasmid containing a DNA fragment having a 382 bp sequence, fully defined in the specification; and (3) a test kit to detect HBV containing an oligonucleotide composition, the necessary nucleotides for PCR and a heat stable DNA polymerase. CnAACCTSYGTCCTCCAAYTTGT (I); GATGAGGCATAGCAGCAGGAT (II); AACGCCGCAGACACATCCAGCGAT (III); and ACGACGGACCACACTGACCAGTCA (IV). n = 0 or 1; S = C or G; and Y = C or T.
56 Entgegengehaltene Patentdokumente/Zitate,
in Recherche ermittelt
CT EP000000523557A1
EP000000569237A2
WO001990013667A1
WO001991010746A1
WO001997040193A2
56 Entgegengehaltene Patentdokumente/Zitate,
vom Anmelder genannt
CT
56 Entgegengehaltene Nichtpatentliteratur/Zitate,
in Recherche ermittelt
CTNP
56 Entgegengehaltene Nichtpatentliteratur/Zitate,
vom Anmelder genannt
CTNP
Zitierende Dokumente Dokumente ermitteln
Sequenzprotokoll
Prüfstoff-IPC ICP C07H 21/00